ClickSeq Library Prep Kit Index Primers
PCR primers required for ClickSeq, Poly(A)-ClickSeq or X-ClickSeq kits
| Size | Catalog No. | Price |
|---|---|---|
| 24 rxn | BCK-RNAseq-IP | € 130,00 |
Chemical Properties
-
Shelf Life
12 months unopened after receipt
-
Storage Conditions
– 20 °C
-
Physical State
kit system made of different components
-
CAS Number
n.a.
-
Preparation/Handling
please see user manual of the kit
Product Information
Primer Index Kit for Illumina-Compatible ClickSeq For 2×12 Reactions
Our Primer Index Kit is specifically designed for use with ClickSeq and Poly(A)-ClickSeq workflows on Illumina sequencing platforms. This kit provides the essential indexing primers needed for single indexed I7 library preparation — ideal for users who do not purchase bulk primers separately and prefer flexibility in kit assembly.
The primers are not included in the standard ClickSeq Kits and must be ordered separately if needed.
Key Features
- Compatible with all Illumina sequencing instruments.
- Optimized for ClickSeq and Poly(A)-ClickSeq workflows
- Provides indexing capability for up to 12 libraries (single-index format)
- Conveniently packaged in a ready-to-use format
Kit Contents (for 2×12 reactions)
- 12 unique indexed primers (i7) provided
Intended Use
This Primer Index Kit is recommended for users of the following baseclick kits:
It enables cost-effective, sample-specific indexing for downstream sequencing based on Illumina i7 primers.
Note:
If you already use your own indexing primers, this kit is optional. However, for best performance and compatibility, we recommend using the validated primers provided here.
FAQ
-
What are the adaptor sequences used in ClickSeq?
The forward primer in the PCR step is:
AATGATACGGCGACCACCGAG
The i7 Indexing primer in the PCR step is:
CAAGCAGAAGACGGCATACGAGATxxxxxGTGACTGGAGTTCAGACGTGT
Where ‘xxxxxx’ denotes the barcode of choice (usually 6-8nts).
-
Is ClickSeq single or dual-indexing?
The current kits contain a click-adaptor compatible only with single i7 indexing adaptors provided in this Primer kit.
-
How many PCR reactions can I perform?
The Primer kit contains enough volume to perform 12 uniquely-barcoded PCR reactions at least twice (i.e. for a total of 24 reactions).
-
Can I substitute with my own Primers?
Yes, provided that the primers conform to the structure provided above. The final concentration of primers in the PCR reaction should be 200µM for each of the forward and i7 indexing primers. PAGE-purified oligos are generally recommended and should be resuspended in water or Tris/TE buffer.
-
What concentration are these primers?
The final concentration of primers in the PCR reaction should be 200µM for each of the forward and i7 indexing primers.