ClickSeq Library Prep Kit Index Primers
PCR primers required for ClickSeq, Poly(A)-ClickSeq or X-ClickSeq kits
-
The Primer Kit contains the primers required in the final PCR steps of the ClickSeq, Poly(A)-ClickSeq or X-ClickSeq kits. Twelve individual tubes are provided, each containing an i7 indexing primer with a unique 8nt barcode and the short PCR primer that anneals to the Click-Adaptor provided in the single-indexed kits.
FAQ
-
What are the adaptor sequences used in ClickSeq?
The forward primer in the PCR step is:
AATGATACGGCGACCACCGAG
The i7 Indexing primer in the PCR step is:
CAAGCAGAAGACGGCATACGAGATxxxxxGTGACTGGAGTTCAGACGTGT
Where ‘xxxxxx’ denotes the barcode of choice (usually 6-8nts).
-
Is ClickSeq single or dual-indexing?
The current kits contain a click-adaptor compatible only with single i7 indexing adaptors provided in this Primer kit.
-
How many PCR reactions can I perform?
The Primer kit contains enough volume to perform 12 uniquely-barcoded PCR reactions at least twice (i.e. for a total of 24 reactions).
-
Can I substitute with my own Primers?
Yes, provided that the primers conform to the structure provided above. The final concentration of primers in the PCR reaction should be 200µM for each of the forward and i7 indexing primers. PAGE-purified oligos are generally recommended and should be resuspended in water or Tris/TE buffer.
-
What concentration are these primers?
The final concentration of primers in the PCR reaction should be 200µM for each of the forward and i7 indexing primers.
-
What are the adaptor sequences used in ClickSeq?
-
-
Shelf Life
12 months unopened after receipt
-
Storage Conditions
– 20 °C
-
Physical State
kit system made of different components
-
CAS Number
n.a.
-
Preparation/Handling
please see user manual of the kit
-
Shelf Life